I don't usually post on here, I prefer to lurk, but I've seen a few postings where people share stories about recent encounters so I thought I'd do the same. I got a kick out of it, maybe you guys will too.
I'm not going to go into the story about my son's mother, how we met, separated, or anything else. It's all in my comments if anyone really feels like going for a dive. I'd like to share current events.
Over the past couple weeks she has gone into one of her "modes" where she pokes and prods about trying to move back in with me, how we're perfect for each other, etc. This isn't uncommon, usually at least once every six months or so, and to be honest I get a bit of satisfaction knowing she has seen the error of her ways but in spite of her efforts she just can't get back in.
This time has seemed a bit different, though. Usually the routine lasts about a week, she gets the picture, and gives up. It's beyond desperate now... hitting me up every single day asking if I'm working from home, asking if she can come over when I say that I am, asking to stay over for the weekend rather than taking my son back to her [boyfriend's] place. She has been pushing HARD. And I think I figured out why.
I took the day off on Monday, and I knew full well that this week we had to go through the parenting schedule for my son due to the rapidly approaching summer break. So when she called and asked if I was working, then subsequently whether or not she could come over I picked her up, brought her back to my place, and we spent a couple hours working over the parenting agreement. I won't go into the details of how irritating it is to try and keep someone like this on-task, but the notable thing was that between the time I picked her up and the time that we finished setting up the parenting schedule so I could ship it off to my lawyer she puked four times. If you don't know what that means, I'll point out that when she was pregnant with my son she had horrible morning sickness in the first trimester. Puked all-the-fucking-time. Of course, in spite of the fact that I was fully aware of how much she'd been puking she still tried to sleep with me and I, politely, declined.
But now I wanted to experiment. The daily requests to spend time kept coming in, but now more provocative. She'd escalated to talking about how she wants to hook up, not even trying to play the innocent "let's just have lunch." So yesterday when asked, like I have been every day since this rotation started, I told her I was working from home. I wasn't, but I was working off of a theory. In slightly more provocative terms, she asked if I'd pick her up so we could bang. "Sure, I'm in the mood. Do you have any condoms? I'm out." Of course, the answer was "No."
"No prob, I'll pick some up on the way." It started a whole shit-storm about how we never had sex with condoms before, she's my son's mother (like that somehow entitles her to my unprotected dick), etc. The end result was basically that if I wanted to use a condom then we weren't going to fuck. I imagine I'll be informed within the next month or two that she's pregnant.
Ha. Nice try.

BlackHeart89 10y ago
Wowwwwwww. How can you not be nearly enraged by this?
Considering the fact that she has as boyfriend and expects you two to have unprotected sex... I would have told her to kill herself.
MotchGoffels 10y ago
Good god your intuition really saved your ass. Bravo!
[deleted]
Entershikari 10y ago
We live in a sick world where future childrens are born from those kind of behaviors.
Waldo00 10y ago
What a CUNT. Scary fucking shit. Someone you shared your life with, had a child with. It doesn't matter. If you can be used you will be used.
conspirized 10y ago
You know, it seems like scary shit... but you eventually get used to it. If anything, when you've had a child with a chick and it doesn't go well you become an adept at these kinds of situations. They play off exactly that shit as much as they possibly can.
Boyfriend and her are fighting? Expect to get blown up, because she's going to want to spend time with / bang you to piss her boyfriend off.
Lost her job? "You don't want your kid's mom to be homeless! I need money to do stuff with him! If you don't give me money then he won't be able to eat while he's with me this weekend!"
Boyfriend is breaking up with her? "We spent so much time together, I realized you're the only one for me, I'm the mother of your child, please let me come live with you!"
The list goes on and on. When you're literally forced to deal with someone and you've got a history with them attempting to play on that shit is their first stop on trying to get someone to cough up whatever it is they want.
tekbiotik 10y ago
Keep strong my brother. You're doing hero work. I wish that my dad was half as strong as you in this situation, but he didn't have the fortune of information at his fingertips that we have now. Fuck her boyfriend, fuck her. They have their own fucked up nightmares to live through. You're doing great, just focus on the ones that matter and that's you and your family.
Paint_It_R3d 10y ago
This is a great post. Guys who have dealt with this have a whole different understanding of AWALT. It's an ugly side but it opens your eye WIDE to the shit that gets pulled. Stay strong man, her shit isn't your shit.
GREF_ 10y ago
What a manipulative monster. AWALT, women are terrible.
Groshub 10y ago
It's so unfair man, why do women have to be like this. I wish you the best.
[deleted] 10y ago
Holy shit. Dude, I think I just came to a realization. That list that you just put out. I just realized that I was the other guy...
I no contacted my ex for two months and she calls right out of the blue. I ended up fucking her. But she was busy on alternating days... like she was dividing her time. She always said she had work when I know for a fact she didn't. Then she mentioned some peculiar to me as I was leaving for a month. She complained about having to "make time for me" while I was in town. She had never done this before. She made it seem like it was a big deal to see me.
Of course, Pre-TRP me shrugged this off. I kept on talking to her while I was gone, and she made a big deal about not being exclusive with me (I wanted exclusivity. Again, pre-TRP). She then said she would stop talking to every guy she was talking to except one. Apparently, she met this guy in the two months we were broken up and she told me that they "only kissed". I said that was bull shit and she eventually she said she would stop talking to him. After that she made another big deal about various other things like going out on "dates" with guys, meeting "guy friends alone" in their apartments, etc. Every night she was starting some sort of fight on topics that she knew I had problems with. Until I essentially told to fuck off and go fuck the other guy.
I feel really fucking stupid for not seeing it now. She was seeing this guy. This guy she mentioned was probably a dude that she was "dating" or almost dating until something petty probably happened and she called me up. She thought that I would only be a quick fuck while she patched things up with homeboy. Instead, I wasn't and she didn't have the guts to bluntly tell me, so she made it seem like it was a gradually melting away.
Another thing popped out to me. The first time we saw each other in that episode we were making out in my car until I felt something wet on my arm. This bitch was crying. She said "I didn't think I would catch feelings for you like this again". LOL. She was crying because she had a guilt of conscience I think. Her new man probably got the whole "we need to take a short break" speech and she didn't think she would care that much when she saw me.
Sorry for the long post, but this is like a big fucking realization for me. While I was at my military FTX I was wondering all sorts of shit about how she was alright with this and how she could rebound so quickly. It wasn't that she rebounded after that little episode; it was that she was already seeing someone and I was supposed to be the quick fuck to take her mind off of it. AWALT
conspirized 10y ago
I think most men who date around find themselves in a situation like that. It's unfortunate, but it opens your eyes.
At least you didn't knock her up, right?
RealRational 10y ago
how do you deal with this one?
Philhelm 10y ago
Easy. Have the child come over for a free meal. I wouldn't send a fucking cent to the ex if the courts already had their hands in my pockets.
Jaereth 10y ago
Then he better just stay here this weekend because you are in no condition to have him over.
s0nicfreak 10y ago
Send the kid to her house with enough food to feed himself, and only himself, for the weekend. If you can, get something the kid likes but the ex doesn't.
iluminatiNYC 10y ago
What I've done is sent over food while my daughter is on visitation. That way, it's clear that my daughter will have something to eat, and her mom can't go act a fool with the money. Everyone wins with that one.
redpillersinparis 10y ago
I think that's unfair to the kid to have to involve him/her in this rubbish.
RealRational 10y ago
I like this one best so far.
GarandTheftAvto 10y ago
Amazon.com food to the house, or use some other grocery delivery service- the online options have really reasonable deals. Easy move if you know where to look, I gather.
Edit: plus you have a SUPER easily readable record of the transaction to show where your money went, what it was for, and how much. Paper trails for the win, always.
conspirized 10y ago
Very much yes. To keep things simple, though: simply following the above direction of sending your child to their mothers' house with adequate food accompanied by a receipt (keep the receipt, to be clear) and a text message that says "I sent our son/daughter with food for the weekend" is just as effective.
flyingwolf 10y ago
I would like to think (and mind you I have never been in this particular position) that I would pull out the cell phone, and ask her to record herself saying this. And record her agreeing that since she is physically unable to care of the child that it is in the child's best interest to stay with me that weekend and she loses that weekends worth of visitation.
I also know exactly how well that would go over.
But then again, I have signs at my front door that say audio and video monitoring in progress.
So I would have it on recording either way.
conspirized 10y ago
Recording laws vary by location. For example: where I'm at I don't require the consent or knowledge of the other party to record them.
That being said, while I'm sure this likely varies by location, denying visitation even knowing full well that the other parent can't take care of the child technically puts you in contempt of court and, therefore, YOU get in trouble for it. There are measures you can take in a situation like that, but when you find out the day of (as is typical) you don't have enough time to act.
When Mom receives the child and doesn't provide adequate care it can land her in a lot of shit that can put you, as Dad, ahead in the race for custody... but no parent wants to put their kid through that shit.
It's fucked up, but it's the way it is. If Plan A (tell her you'll keep the kid since she can't take care of it) doesn't work, then Plan B (send kid with food) is the best route (as a parent) to take.
bustanutmeow 10y ago
You should be using this to get full custody, Sure it might suck to miss out on food for the day, but its a lot better in the long run.
Mindblind 10y ago
Ok, if you can't feed him I'll take care of him till you're back on your feet.
conspirized 10y ago
This is typically the attitude I take and it works for me: the end-result is that she leaves him with me (if she legitimately can't take care of him) or she magically finds a way to take care of him without using my money.
This may not work for everyone. /u/RealRational is correct in his statement.
RealRational 10y ago
But how do you do that when she has court ordered visitation?
I have some experience with divorce, they won't allow you to just keep the kids when she's supposed to have them.
Mindblind 10y ago
You're not taking him away from her, she can't provide for him and you are offering a solution. If it came down to it, they aren't going to allow the kid to starve.
conspirized 10y ago
He's actually right, though.
Here's the fucked up thing: you can't tell her "no, you can't take our son this weekend" even if you know she doesn't have the means to provide. You are then in contempt of court because you refused to allow her to have the child during the allotted time.
Now, if she takes him in spite of not having the means to provide and, therefore, he doesn't eat all weekend it does look extremely fucking bad for her. Like... you can file for emergency custody and shit bad.
But... do you really want to put your kid through that? Sure you can get a short-term advantage, but trust and believe if the mother of your child is willing to put her own kid through that kind of shit she's going to fuck up worse down the road. As a father, I'd opt for Plan B as mentioned below and just send him with some food then throw the punches when openings present themselves further down the road. Making your kid suffer, even for their own good in the long-run, is not a wise tactic. Even if it were, as a decent parent you won't be able to force yourself to do it.
[deleted]
RealRational 10y ago
When I Google that I get Chicago Public Schools. Could you leave a link for those interested? It's what I was going to do.
myrpaccount 10y ago
I meant child protection services. That's what they call it in my state.
Deresetese 10y ago
You give her exactly the money she needs for the son.
If she treats him badly, report her.
With this I'm not sure but I believe if she isn't able to pay for the son for an extended period or pretends to not be, you can deny her access to the child.
conspirized 10y ago
You got downvoted to oblivion, and that sucks.
Where you're wrong is saying simply "give her the exact money."
When you're in a situation like this, cash is not an option. If you REALLY feel the need to provide her cash you do it via an electronic transfer - the important thing is the paper trail.
Generally speaking, though, what someone in a situation where Mom really needs something (e.g. diapers, food, etc.) should do is to buy the things that she needs to provide for child, keep the receipt, and accompany said purchase with some form of recorded communication such as text message or (depending on the laws where you live) even a phone call or recorded physical interaction where you clearly state what you are sending to help provide for the child.
This, combined with a recurring failure to be able to provide for the child, may result in an advantage in court.
People are right when they say never give her cash. Never, ever, EVER give her cash. Keep that paper trail.
s0nicfreak 10y ago
No, don't ever give her money outside of tracked child support. If it's ever questioned, she could (likely will) deny you gave it to her.
Don't ever deny her access without court approval. You risk losing custody completely for that.
Give the kid enough food for himself for the weekend. If she is really homeless, she'll have to rent a motel room for the weekend or something. (How does she afford that? Her problem, not his.) Document everything (that she is telling you she's homeless, that you are buying the food for her weekends etc.), and take it to your lawyer.
foldpak111 10y ago
She can prostitute herself out for a night, it's nothing she hasn't done in the past.
Deresetese 10y ago
I didn't mean to do it without court approval, sorry if it sounded like I did.
RealRational 10y ago
Gawd, you're absolutely right but listen to all that conniving and bullshit you have to do. All the things you have to record and have documented. What a nightmare. That's not even to earn anything, to achieve anything, that's just to keep what you've already earned. What an insane price for literally no value in return.
Deresetese 10y ago
It's annoying for sure, but I don't see a better option.
There is no way any court will allow him to keep the child alone unless she treats the child badly and this is documented.
And just giving her what she wants is not an option obviously.
CornyHoosier 10y ago
My buddies ex-wife (and mother to two of his children) has lied so much that the system makes them communicate via a 3rd party call/text/email system that is monitored by the state.
Thankfully the mother only sees the children quarterly now. Technically, she should be paying my buddy child support but he makes enough money to tell her just to fuck off.
Their newest development was just last month. She said he sent the kids to her place with nothing but dirty clothes and no bathroom accessories. Considering this guy is one of the most organized neat-freaks I've ever seen, I don't believe it for a moment. So now he said he is going to have to take photos of their luggage every time he send them to visit her in Tennessee.
RealRational 10y ago
This is the shit that makes me think women are pure evil. I just gotta remember everyone has those impulses, hell if we were still tribes and shit I'd solve many a problem by just killing the problem maker, but within' us all is the capability to overcome those impulses. To choose to be better. The trick is to identify them accurately, and not get fooled by all those hormones fucking up your reason to the point where you can't think clearly.
Part of progress, growth. You gotta leave things behind. As society matures and grows we had to learn to leave murdering behind as a means to problem solving. We gained a hell of a lot for that price, but we're going to continue needing to leave things behind in order to progress. The 1950's "stepford wife" homemaker ideal is one of those things. Now, society did what it does and over corrected on that account, but the sentiment expressed by some members of this community that we should, or even that it would be good, to try and return to that "ideal" is foolish, and ignores the reality we live in.
Little tangent there, putting together a rather large post on the topic that I'm not sure of what direction I want to go in yet. You got some of the raw data thrown your way, heed appropriately.
[deleted]
[deleted]
[deleted]
[deleted]
MentORPHEUS Senior Endorsed 10y ago
Wow, bullet dodged, and great write-up for those still pedestalizing women. I remember the young days of disbelieving that any woman would do that ever, except for a few obviously crazy outliers.
Bippotybop 10y ago
When they get desperate for control they will try things like this. She must feel like a whore knowing she has yet another baby daddy... Which will obviously never last since she's seeking the D elsewhere. Good job maintaining frame here.
kick6 10y ago
I learned at the ripe age of 24 when I knocked up a seperated-but-still-legally-married chick, and she flat out told me she was considering slithering back into bed with dude, and pretending it was his.
FattestRabbit 10y ago
God, this word is so spot on it kills me. These women are snakes.
FuriousMouse 10y ago
No, these women are simply women. This is how they are. Orbitters, shit-tests, CC it is all a part of womanhood and it all makes sense for their reproductive strategy.
laere 10y ago
What made me chuckle is she basically implied to him what she was trying to do.
Haha, jesus christ the fucking nerve women have.
That was some good ass matrix bullet dodging.
nrjk 10y ago
Is it nerve or just really shitty strategy? I'd imagine a person who can use her feminine wiles (see: pussy) with relative ease won't really develop a good sense of interpersonal strategic thinking.
This behavior is obvious to other women...especially older women, older men and some RP dudes.
It's not obvious to both sex-starved, knuckle dragging cavemen who "just wanna fuuuck"and sex-starved, whiny men who get "lonely" and "have to work out 'issues'" at various times in their lives.
HumanSockPuppet 10y ago
Yes. But it's only obvious what's happening when you've taken the Pill.
For most sex-starved guys, a sudden opportunity to hook up with an old girlfriend or spouse seems like a good thing. And they fall for it more often than not.
BlackHeart89 10y ago
In my blue pill days, I might have fallen for that. But my spider senses would have kicked in once she got mad about me using a condom, despite her having a boyfriend. I would have just begged to fuck with a condom and later ended with my texts being ignored.
Better than being setup though...
Claude_Reborn 10y ago
The matra should be "ex's are ex's for a good reason"
Day_man2020 10y ago
I don't have ex's I have y's as in why the fuck did I date you. Not my line, don't remember source
FattestRabbit 10y ago
-/u/Day_man2020
But I'm totally stealing that
pilledgod 10y ago
Confirmed: I started reading here just in the nick of time. Just recently, after using a condom and getting up to throw it away, she said "you can put it in me." Suffice it to say, I "went to the bathroom" and washed that motherfucker out with soap and water. Do not underestimate female insanity.
BlackHeart89 10y ago
Wait. What? She asked that you put the condom back inside of her? Wtf?
RP_on_TV 10y ago
I flush mine. I don't care if it's bad for the plumbing.
IsItJustified 10y ago
That causes countless problems. Do not flush condoms. Ever. Stop it.
vengefully_yours 10y ago
I had a vasectomy, so I leave them in the trash. Good luck getting knocked up by me bitch. White hot sauce works well too...
[deleted] 10y ago
Where can I get this sauce?
vengefully_yours 10y ago
I don't know, I don't need it. You sure pulled this one out of the dustbin.
user_none 10y ago
That vasectomy creates such a feeling of freedom.
vengefully_yours 10y ago
Fucking eh it does. I know there will be no more kids sharing my genetic code, and thus no more women who can be awarded the majority of my income.
tokenblakk 10y ago
Did...she say...you could put the used condom inside her? And completely negating the (main) reason you used a condom in the first place??
[deleted]
Stormhammer 10y ago
some women really fucking want a baby.
foldpak111 10y ago
The benefits is more like it
tekbiotik 10y ago
Baby with benefits, shit that's better than getting a job!
Stormhammer 10y ago
I'm more referring the maternal/biological clock ticking that hits women
AFPJ 10y ago
All of ya'll are seeing danger, I'm seeing opportunity. If OP still finds his ex's body attractive, this was the perfect opportunity for him to fuck her and come in every way & hole he wants for weeks. The math adds up, she's already pregnant beyond any shadow of a doubt. And the thing about pregnant chicks is... you can't get them pregnant.
While she's busy taking you to heaven by sucking, fucking and doing whatever you command her with your load as long as it ends up inside her, engrave the depth and magnitude of deception women readily perform into your mind.
Take it from me, done this plenty of times after sneaking in pregnancy piss tests. Moves & counter moves baby
conspirized 10y ago
No, bad idea. There's a whole slew of potential risk; first and foremost: while it does seem obvious I still can't say with absolute certainty that she is in fact already pregnant. I haven't seen test results, she didn't piss on a stick for me and she's not going to.
Second: This isn't a girl that I can just put on the "ignore" list for my phone and stop interactions with when I'm done fucking her. I have to deal with her for at least the next 12 years, and while it's not my responsibility to keep her happy it does make my life easier to not stir up shit when I don't have to.
There's more than enough pussy out there to keep me happy without touching that one.
cheezuzz 10y ago
But you could also have banged her and then dumped her and written a brag post about how RP you are that you just plated your ex for a day and dumped her and she's so desparate for your cock now that you're RP that she sucked it for hours and deepthroated and let you cum in her ass and then sucked it out with a turkey baster and drank it. But you didn't do that. You are a smart man.
AFPJ 10y ago
There's only so much a woman can do to make your life hell and the one who left you likely depleted her capacity for doing so at that time. Alas it's your situation, so naturally you know best - all I'm saying is know your options
Tainted_OneX 10y ago
In no situation would that be a good idea. There are billions of women on earth, why get stuck up on one if she's crazy. This is basic red pill knowledge.
NightGod 10y ago
As a man who just recently hit my freedom date (youngest turned 18 in December, about 11 years after we divorced), I can say from personal experience that there are very different considerations when you have children together, assuming you are playing an active part in your children's lives.
Don't forget that our court systems are STRONGLY setup in favor of the women in these situations and they can easily drag you back and make your life hell and then leave you to pay their attorney fees when all is said and done. It's far easier to work to keep them on an even keel ahead of the fact so it never gets to that point.
Just think of it as the longest plate you've ever spun, even if the sex is a lot less common than it normally would be.
tallwheel 10y ago
...and it's plenty. Women can do enough to drive men to suicide on occasion.
conspirized 10y ago
Fair enough.
Trust me though: this one isn't worth the headache.
MentORPHEUS Senior Endorsed 10y ago
Nope, bad idea. I've dealt with women claiming to be pregnant and inviting me to cum inside them. Even if I watch her pee on the stick, this situation spells DANGER WILL ROBINSON, greater than the pleasure possible from fucking her, even 9 new ways to Sunday.
[deleted] 10y ago
Jesus christ you are fucking stupid. Jump through tons of hoops all so that he can get some old pussy he's already had many times before? You're pathetic.
magus678 10y ago
This sounds nuclear level moronic.
AFPJ 10y ago
In OP's situation perhaps so since she already has one of his - other than that, care to elaborate?
magus678 10y ago
Any woman you would suspect of this kind of behavior should be given as few handholds on you as humanly possible.
The risk is defcon 1 (edit: me no know defcons) while the reward is what, revisiting some old pussy? Just get a different girl. Fuck even a prostitute is light years cheaper than another child support payment.
Elodrian 10y ago
DEFCON 5 is the lowest threat assessment level. It goes up (down) from there.
blue_27 10y ago
DEFCON (DEFense CONdition) 5 is peace. It counts down to war.
AFPJ 10y ago
Did you miss the part where I said "after sneaking in pregnancy piss tests"? The risk is zero, thought you were about to go on a rant about how it's not moral to use someone trying to destroy your life to benefit theirs heh. Shit's not rocket science, 5-10min of good handiwork gets you weeks to months of sex if test is positive. If not, move on.
Unless you're completely reckless, she shouldn't have any leverageable details about your life so where's the risk?
This is literally every woman. Are you new to RP? Legit question, not trying to be snide or coy here.
tallwheel 10y ago
You really think so? In most cases you can't force her to get a DNA test, and in most places she can pretty much name whoever she wants as the legal father. Fucking her and giving her any room to claim you're the father is about the dumbest thing you can do. If you've never fucked her, at the very least she's going to have a helluva time trying to tell you with a straight face that you're somehow the father. OP needs to just stay as far away from that pussy as possible to minimize any possibility she's going to try that shit...
magus678 10y ago
I saw what you said. It is still a horrible, horrible idea.
Best case scenario you still have to go to court to play Matlock if she wants to be a bitch. It goes without saying that weird shit like this is not looked upon kindly by judges, who already would love to nail you to a cross as it were.
Even if you get away with it, why bring that kind of heat in your life for some pussy you should have been over years ago? It is poor risk assessment, and poor cost/benefit analysis.
Abundance mentality.
AFPJ 10y ago
Edit: votes point to my opinion differing from the hivemind on this topic; guess that means im wrong here
Last rant incoming
I already said this wasn't strictly for OP's case but for women you have little/no previous contact with. If she wants to drag me out of whatever random hell hole on earth I'd be sent to next and into a cozy courtroom, I'm all good with that actually. But I don't think even women are that fucking stupid. Think about it. You go through the motions and ask her if she's on bc before sex, of course she lies. After that talk happens in court (she denies making that claim), you volunteer for a test. She accepts? Case ends. Declines? Case dies. Either way, counterclaim.
The above is too theoretical for my taste (or to be useful) but the point is, shit's not happening. I've never even been called to court. You underestimate how much shit you can get away with, even as a tall white male in the great USA.
Speaking of that last point, can I get my kicks elsewhere? Sure, I got lucky at birth and so it's not hard. But when I am stateside, time's sparse. Right now there's probably no women within 100 miles of where I am & I'm just managing business / amusing myself here on reddit, but whenever a dumb broad trying to pull something this stupid comes around I get to keep fucking her for 10 weeks after 10 minutes of effort, that beats the hell out of what you'd find in a club on even the best of nights.
I know guys who play the riskier part of being the daddy and they probably have a few kids out there, none have ever heard shit from the girls they fucked and came inside. It's almost as if evolution found it favorable for the top male specimens to be unconsciously shared and even guarded - by females, of all things. Curious, isn't it?
Chicks riding hot cocks and then rawdogging a mix of alphas / betas months later so they can start working on a dozen betas at the same time to find out which one she can fool into being daddy is as old as time itself, why not take advantage of the phenomenon? If you're on the tail end of the cycle & she's already preggo, its free fucking.
We're beating a dead horse though, your analysis has risk, mine does not. Neither are unreasonable perspectives
MajorStyles 10y ago
This is how most women are having children these days - fraud.
Really, most guys I know who have a kid from their twenties with a crazy bitch were duped.
Boys, you better be careful. This is war. Most girls don't care about love or happily ever after. It's about gaining resources, using a child as a hostage.
rorrr 10y ago
Make sure she doesn't put your name on the birth certificate.
conspirized 10y ago
Fortunately I live in a locale where she can put my name on the certificate, tell it to the welfare office, etc....
I'll receive a sealed notice at my work, I'll see said notice, sick my lawyer on her, take a paternity test, and be free and clear.
Not something I need to worry about.
CrazyHorseInvincible 10y ago
Re-flaired to "Field Report". Good stuff.
conspirized 10y ago
Thanks, will try to classify better next time.
mordanus 10y ago
That was a great story man. I can't stop chuckling over. Thank you very much for sharing. It's funny how obvious people can be and they have no idea.
[deleted] 10y ago
Sex is just a weapon for some. Just "bang". No.
AntixD 10y ago
did she show any cuntish ways before marriage?
conspirized 10y ago
We were never married.
To answer your question, though: I was relatively BP-ish when it came to actually being in a relationship back in the day prior to my entire mess with her. The signs were definitely there, but I was too ignorant/brainwashed to see them for what they were.
I didn't discover TRP till late last year, but the entire experience with her basically unplugged me. Won't fall for that shit again, for sure.
AntixD 10y ago
okay thanks brother,just wanted to know if i could fall for the same trap even if knowledgeable
[deleted]
urallphux 10y ago
Amazing story, thank you for sharing.
Paint_It_R3d 10y ago
Nice work having a little fun with this situation. Once you've been with a bitch like this, you know these tricks all too well.
[deleted] 10y ago
Does she think you are an idiot? I mean who would fall for this stuff? Jesus Christ.
iHeartCapitalism 10y ago
Really makes you glad to have found TRP, and have the ability to see through this, doesn't it.
Temuzjin 10y ago
I might have fallen for this pre-TRP.
Deresetese 10y ago
Sadly there are many people who will give her the benfit of the doubt there and play it off. She's desperate
Tarnsman4Life 10y ago
Legions and legions of thirsty guys can and do fall for it, every single day. "Just once baby"
UnsafeReload 10y ago
Thirsty? Is this new slang for horny? I've been seeing this on Reddit a lot lately but never heard of this previously.
Tarnsman4Life 10y ago
Men who are too eager/desperate for female attention
http://www.urbandictionary.com/define.php?term=Thirsty
[deleted] 10y ago
Yeah, but how can she think that he won't get it when she pukes four times while they are together?
Women are weird.
GrandpappyLuke 10y ago
What does puking have to do with it? Is there something I'm missing?
[deleted] 10y ago
Morning sickness? Pregnant women puke a lot in the first trimester.
1003rp 10y ago
Morning sickness is not as common as it is made out to be, but since he already stated that she had morning sickness with their child, it heavily points to morning sickness. Also, if she were vomiting because she was sick I'm sure she would be none stop talking about it
[deleted] 10y ago
I'm almost impressed with how fucking devious and calculating women appears - this is how it is with men of power. But no, women just do this shit instinctually. Their inferior physical strength means they have evolved to be machiavellian masters, by instinct! Fucking scary.
xwm 10y ago
People who are assured that their
womangoddess can do no wrong.People who are so addicted to crap tv, masturbation, sugar, pot, and other mind numbing crap that they can barely think in this time zone.
People who believe it is ok to stress out over everything, or that they are special regardless of their low IQ.
People who assume that everyone else is as caring and generous as they are.
Basically anyone who hasn't been pulled out of the coma that is our current society's "logic is morally wrong" stance
[deleted] 10y ago
[deleted]
TurgidMeatWand 10y ago
Some stoners get stupid high every time either because they smoke too much or thier body/mind just has that reaction to it. People who have the "dumb stoner" stereotype is really just because people who are stupid with or without weed like to let people know they smoke weed.
no_username_needed 10y ago
Dude isnt a smoker. Mary huana definitely has a tendancy to open your eyes more than close them.
link5057 10y ago
Its like you can visibly see any bullshit they spew when youre high
xwm 10y ago
You sure what you took wasn't labeled lsd?
xwm 10y ago
All the shit that we numb our brains with contributes.
enjoyit7 10y ago
When I'm high I can see bullshit so clear. Everything is so clear. Life is clear. Time to light up.
kick6 10y ago
Oh look, a pot smoker who thinks he's better at everything when high. Who would have thought...
Here's a hint: all the sober people watching you do stuff high think you suck at it.
Signed,
Guy who burns without blowing smoke up everyone's ass.
[deleted]
iluvpeople 10y ago
OMG, I didn't know women were this crazy!
[deleted]
CowardlyPetrov 10y ago
I think this was maybe a 5/10 on the crazy scale. What do you guys think? I'm just going off observation here, but seems like a very basic level of woman crazy and I have seen a lot crazier.
Don't tell me that other women in DIFFERENT CIRCUMSTANCES would behave differently. Tell me honestly, in the same exact circumstances wouldn't most women try the same bullshit?
NightGod 10y ago
Yeah, 5-6 range sounds about right.
[deleted]
[deleted]
[deleted] 10y ago
It's like something straight out of a horror movie...nice catch man
conspirized 10y ago
To be fair: still the best lay I ever had.
17, young, and dumb results in shit like this.
[deleted]
[deleted] 10y ago
This sounds like an amazing episode of "Maury" .. I can already picture her running off stage when he tells you that you're NOT the father
copralalic 10y ago
He wouldn't laugh and run offstage. He'd just sigh, shake his head, and say, "I fuckin' knew it already." The ex's boyfriend would be the one running around on the stage then.
[deleted] 10y ago
She would run off stage in tears. He would be the one high fiving the security and audience members
copralalic 10y ago
I haven't watched the show enough to know exactly what would happen, but it would be gloooooorrrious, I'm certain.
cover20 10y ago
The women typically have a breakdown when a guy isn't the dad. The woman is desperate to find a cash flow stream and the intensity of the breakdown shows that they would do literally anything to get it.
Watch those shows if you're ever thinking of sex with a single mom or otherwise associating with her in any family-like role.
Goldfulgore 10y ago
Here is a disturbing and unpleasant thought I just had:
Could she had done this in the past? Is your son truly your son?
I would check this out if I were you.
conspirized 10y ago
She could have tried.
If you dig through the comments, someone has already asked. You could tell in the ultrasounds that it was my son, and despite that fact I got a paternity test and he is my son without a doubt.
Goldfulgore 10y ago
Then allow me to join the rest of the comments and say to you wholeheartedly that you probably dodged a bullet. Like Neo who took the Red Pill.
Only time will tell whether she was really pregnant.
MadeSomewhereElse 10y ago
This is why I am getting a vasectomy.
[deleted] 10y ago
[deleted]
conspirized 10y ago
I can provide an update when I get more information. Like I said, I'd expect to find out about it in a month or two. She'll likely ask me to pay for the abortion.
I'm not even kidding.
[deleted]
TheRedPhil 10y ago
She threw up four times and you need more proof?
dat_shermstick 10y ago
Maybe she's just coming down off heroin or something. Wouldn't be surprising.
conspirized 10y ago
This is a very real possibility for her, she's already been hooked once. That's how I ended up with primary custody, and it's already the reason I went ahead and gave my experiment a shot. If she was just trying to hook back up with me, get money, etc. she'd have been fine with condom-sex.
dat_shermstick 10y ago
...does she happen to be a stripper as well?
conspirized 10y ago
She only stripped for about two weeks, that I know of.
newls 10y ago
Kind of amazing that even though she currently has a boyfriend and there's no evidence you slept together that there's a real chance she could try to name you as the father.
conspirized 10y ago
Where I live she could tell the hospital I'm the father, tell the welfare agency I'm the father, preach to the highest mountains that I'm the father.
They'll send a notice to my work, I'll take a paternity test, and I'll be fine.
I'm aware that I'm lucky for that.
bam2_89 10y ago
Get a vasectomy. Tell no one. Let her do it hats off, then wait for the news.
[deleted] 10y ago
[deleted]
conspirized 10y ago
I am very good at interacting with other people, the catch is that I am only good at it in person. I can get what I want from her, but I can't do that over text message / e-mail. I could spend hundreds (if not thousands) of dollars paying my lawyer to do it, or I can do it myself for the cost of a trip across town, a headache, and couple hours of my time.
I like my money.
[deleted] 10y ago
[deleted]
conspirized 10y ago
Look... I'll do just about anything for the right amount of money... so for the right amount: I'd hit that shit again.
Barring those circumstances: I'm going to assume you've never been in a situation like this. It's fucked up because you're literally forced to have interactions with this person that you would otherwise have absolutely fucking nothing to do with. It's not like a normal relationship (or non-relationship) where you can just shrug her off, blow her off, have zero interaction with her because there's nothing to be gained.
You have a third-party (family court) that will see that kind of shit and point the finger at you; they'll say that you're being uncooperative, that you're not willing to work with the other parent, and next thing you know your kid ends up being FUCKED (especially if you have a boy: those raised exclusively by their mothers can testify, I'm sure) because the court, having little or no understanding of your situation, throws him to Mom.
And it's not even like that for me. She's dug herself into a hole so deep over the past three years that I could point the finger at her, tell my lawyer to go, and he'd rip her a new asshole. But you know what? That shit costs $150 AN HOUR. She can talk for an hour about absolutely nothing without even hesitating. I'm not paying that kind of money.
So yea, I'll put up with her shit for an afternoon to get what I want.
EDIT: Fuck, you're a troll... aren't you?
iluminatiNYC 10y ago
As someone who is a single dad, I think you played with fire. Still, you got out of there unscathed. Well played, and enjoy yourself. :)
conspirized 10y ago
I'm aware, but someone else in the thread pointed out that it could have been a result of coming down off drugs. While I'm aware that she doesn't want to bang when that's the case, she has a history. The experiment was a way to confirm one way or the other.
Just trying to hook back up? Wanted money? Condom-sex would have been fine.
aazav 10y ago
Way to prevent her from trying to sink her claws back in since she got knocked up by a guy who can't provide.
You're not her next kid's father and she's not entitled to your income to raise him/her.
You just dodged a bullet. A very expensive bullet.
TekkomanKingz 10y ago
There is an old saying you shouldn't try to strike gold twice in the same location...
Cant_Tell_Me_Nothin 10y ago
Shit, that's some stone cold ruthlessness from her. Perfect example of how not to expect women to follow any code of ethics. They live by different rules. Self interest at any cost.
HumanSockPuppet 10y ago
You can't blame them.
Women in general lack the willpower, the discipline, and the practiced ingenuity to flourish on their own. They can survive well enough, but not flourish.
And survival isn't enough when it's 2+ mouths you're trying to feed.
That's why they do everything in their nature-given capacity as persuaders and manipulators to get men to provide for them.
md619 10y ago
Can't forget this. In evolutionary terms a woman without a man's commitment was fucked. This script is still hardwired in them even if it no longer makes sense in modern culture.
[deleted] 10y ago
This should boost your ego as well, her trying to pin it on you was an obvious sign that she recognized you are a better provider than anyone else she knows. This might not be something to brag about, but it appears to me you have your shit together, and solid.
conspirized 10y ago
My ego doesn't need any more boosts.
Still, yes.
jb_trp 10y ago
I'm guessing you make a lot more money than her current boyfriend, and are probably a better father figure, and she wants to procure your goods and services. I hope you haven't had sex with this woman recently. And if you have, demand a paternity test when she accuses you of being the father.
conspirized 10y ago
Not for over a year, and I won't. I can't just cut contact with her (obviously) but I sure as hell don't have to bang her.
jb_trp 10y ago
That's good. If this woman is particularly dubious, she might even lie at the hospital and put your name on the birth certificate anyway. There have several men who have been screwed into having to pay child support for children even when paternity tests show they are not the father (just do a quick reddit search of "Dad by default"). If she tries this crap, lawyer up and get the appeal paperwork in on time!
conspirized 10y ago
I've already got a lawyer, my bases are covered. I'd say I'm surprised she thought I was so dumb that she could even try this, but she does tend to think she's exceedingly clever.
Hint: she's not.
copralalic 10y ago
Did your lawyer get a good laugh, too?
conspirized 10y ago
His time is my money, so I'm saving my story for the next time we have to communicate about something important. I have no doubt that he will; he finds most interactions with her fairly humorous.
[deleted] 10y ago
Have you tried getting a girlfriend who will do the shielding of her from you? As in the girlfriend will do the subtle bitching when she's around so she gets more pissed of on visiting you. This may affect your time with the child though. But this idea could be a starting point.
conspirized 10y ago
She's fucked up so much that nothing short of drugs / abuse will affect my time with my son. Custody is on my terms, now.
As far as the girlfriend thing goes, I definitely favor LTR's but between my son, my career, and my recent endeavors to get more in-shape I haven't really had the time to go looking. The few girls I have hooked up with over the past few months weren't really what I considered LTR material. I guess I'm kind of in monk mode, maybe in a few months I'll consider it.
[deleted] 10y ago
Alright, once you get lucky enough to hit an LTR material (it's always a dubious thing though), I can imagine the subtleties on encounters between an ex-wife like yours and an LTR will make for a hilarious spectacle. It'd be nice if you share us some of the kicks you get out of it!
conspirized 10y ago
During my son's first year of life my parents were going through bankruptcy. They moved out of state and I "inherited" their 5 bedroom, full basement house while waiting for the bank to come and claim it. I rented out 3 of the rooms to strippers, and they kinda played bodyguard for me when it came to my son's mother.
It was, indeed, hilarious. If I get an LTR, I'll be sure to share.
[deleted]
MattyAnon Admin 10y ago
Paternity testing should be mandatory. No man should ever have to ask. No woman should ever have the option of duping any man ever again.
conspirized 10y ago
I totally agree, except that someone would have to foot the bill. I know when I got mine done it was like $600, which was almost a month's salary for me at the time.
[deleted] 10y ago
Considering a birth cost 40k they can just tack it on.
[deleted]
bluedrygrass 10y ago
We already have to pay the bill for women's contraceptive pill.
TW_RPAwake 10y ago
A simple blood type test has the potential to rule you out with 100% accuracy. If the test indicates that you could possibly be the father, then shell out the $$ for the full DNA test.
RealRational 10y ago
Why do you guys downvote him? Do you not know how DNA works? Depending on the blood type of the father and mother it's possible to rule yourself out as father with a test that is, effectively, free. Why not do it?
Then, just like he said, if the kid had one of the possible blood types get the full, expensive test. Granted depending on parental blood type, of the mother or father, it could be an irrelevancy. But in half of cases it won't be, and in half of those the results would be definitive. Far from a complete solution, but considering the cost/benefit ratio it's a much better investment than the full DNA test, IF it works for you. $1 to get either a definitive no or a maybe vs $600 for an answer that's 99% accurate either way. 1 answer for a dollar or for 600? Seems to me it makes sense to try the dollar first no matter what.
MattyAnon Admin 10y ago
Calculate the odds, calculate the payoff. I'd happily pay that and be happy I did for either result.
Nothing will stop her cuckolding you the second time around faster than seeing you do the test the first time :D
conspirized 10y ago
Totally not saying it's not worth it, I think every man should get a paternity test, even if they're 90% sure it's their kid.
Like I said in another comment, he was a spitting image of me, she would have had to reproduce with a serious doppelganger to provide those results.
Still got a paternity test. Better safe than sorry.
copralalic 10y ago
I could build a PCR for ~$1000, materials about ~$25 a test, with an error rate of 1/16. I charge you ~$50 for the pre-test, if you still question you pay the $600 for the real deal. I'd have a lot of takers, I bet.
(Legal mumbo-jumbo... )
conspirized 10y ago
That'd be nice for a situation like mine where (at the time of the test) I didn't have any legal reason to need it. Guarantee you the $600 test will be required to be considered in court, though.
Dualmilion 10y ago
How does that work? If she came to you and said here's a kid it's yours, you say fuck off no its not, what happens from there? Are you then forced to pay the money for the test?
conspirized 10y ago
It varies by where you live.
Where I live, she goes to the court and says "It's his kid, so he owes me child support."
At that point, a smart man will say "Well, I'm not sure. I don't think it's my kid." If you don't take this step, you pay child support.
Assuming you denied that it's your child, the court will say "Okay, prove it."
At that point, as the man you are required to go and finance a paternity test. With a court order she'll be forced to partake (give her DNA) as well. You don't NEED her to partake most of the time, but my understanding is that sometimes the results are inconclusive and the mother's DNA makes it a bit more conclusive. I didn't have this problem.
If you're not the father you're free. If you are you're now officially invested.
Dualmilion 10y ago
thats so fucked that the burden of proof is on the father. what if he cant afford it?
conspirized 10y ago
Best advice I can give: the strong man will always find a way.
That $600 is not shit compared to 18 years of child support.
RealRational 10y ago
Insurance should pay it. We have to pay for their fucking birth control and pap smears and a bunch of other expensive medical bullshit that ONLY affects females. Stupid healthcare law, BB government raping us again.
edit: Car insurance is segregated by gender, men pay more because they "supposedly" cost more. Either all insurance should be equalized between gender, making it a non-factor, or healthcare should be segregated by gender as well, which would mean men pay significantly less than women on healthcare premiums. Since everyone knows women have significantly higher healthcare requirements.
rebuildingMyself 10y ago
That's what happens when you try to apply logic to feminist-infected legislation.
[deleted]
RealRational 10y ago
I'm not a doctor, if I were in that position you can bet I'd have the best advisers on earth.
Ok, I see your point, it's preventative maintenance. Not birth control mind you, since they can and SHOULD pay for their own damn pills just like we pay for our own condoms. But the other stuff, I don't know enough about so I'll just take your word.
But even so, why should men pay for those things? It should be only the females who pay for those services in insurance. Or do you think we should raise the rates on women for car insurance? Cause that's exactly what's happening here, men pay more for car insurance because they're deemed "higher risk". If that's not wrong then neither is women paying more for medical insurance because they are provably higher maintenance.
Note: My insurance agent was telling me, off the record obviously, that over half of car accidents that get reported on cars registered to men are actually being driven by women. He said that really fucks with the numbers and if that was taken into account women would be paying FAR more for car insurance than men. Just an interesting fact that society won't let be published anywhere.
RedHeimdall 10y ago
It sure as fuck advances the standard of living for the man being forced to pay for a child that is not his.
All kinds of insurance factor in risk when issuing a policy and determining rates. If you've totaled three cars and had six DUIs, your auto insurance rates will be higher because you represent a higher risk. If you're 18 your rates are higher than if you're 45 because you represent a higher risk.
For health insurance the situation is reversed with age --- if you're a healthy, active 20 year old you represent less risk than would a sedentary 60 year old lifetime smoker. Likewise if you have a history of bad health you are more likely to cost the insurance company more money in the future. Up until recently, you might have even been denied coverage altogether if you had serious pre-existing medical conditions.
Past behavior is strongly indicative of future behavior.
Now it's been made illegal for health insurers to deny coverage for pre-existing conditions. How much farther than this it goes, I'm not sure. Do they still charge older people more than younger people? Do they still charge smokers more than non-smokers? Do they charge people with serious pre-existing conditions more than those without?
I'm betting that the answers to some of these (and similar) questions are yes. That is the free market working: to charge more for an insurance policy that is likely to cost the insurer more. Government has stepped in and limited the scope of this market pricing mechanism, as they have in many industries.
But as ever when you mix socialism and capitalism the question is: are we going 100% commie where everybody regardless of differing circumstances is treated as identical? And if we're stopping short of that, which groups are given special treatment (in this case, exemption from market pricing) and which are not?
Women cost more. Do they have to pay more? If not, they are being singled out for special treatment.
[deleted]
zyk0s 10y ago
I think you just discovered an excellent solution then. Reverse the default, make the man not responsible for paying child support until it's proven he is the father. If no man is proven to be the father in this fashion, push child support onto the tax payer.
Then observe as the government forces insurers to cover routine paternity tests within a year of this change.
[deleted] 10y ago
[deleted]
vengefully_yours 10y ago
The state don't care who the father is, they care who pays. They will do anything, legal or not, to force a man to pay.
conspirized 10y ago
It varies. As far as I'm aware, no one requires a paternity test for child support... you can simply get one and contest the support if you're proven to not be the likely father.
Some places will charge you child support if she simply puts your name on the birth certificate and you don't contest it in a timely fashion.
Some places will charge you child support if you and her were married and are divorcing, even if none of her kids are yours, because you assume responsibility as the father when you marry her.
It just depends on where you're at.
EDIT: Sucks that you're getting downvoted, it seems like you legitimately just don't know.
zyk0s 10y ago
Not exactly. The way it works is that a woman claiming benefits for being a single mother must name the father. Whoever she names is assumed to be the father and the state can then go after him. What I'm suggesting is to reverse that. If a woman wants to claim benefits, she gets taxpayer money, then if the government want to go after a dad, they have to prove he is through paternity testing. It's a subtle change, but it's closer to "innocent until proven guilty".
s0nicfreak 10y ago
It could save/make more money for insurance companies though. They just have to say that if they aren't told the real father, they will not cover the kid. Once they are told the real father, they can say he has to put the kid on his insurance too. If this is a different insurance company, then the first insurance company pays less; if it's the same insurance company, they are now getting paid by more people for covering the kid.
[deleted] 10y ago
[deleted]
bzzltyr 10y ago
Why would any business help spend their money on something that makes no impact on their bottom line? This is basic capitalism.
bluedrygrass 10y ago
Because our "capitalistic" governments are ever more socialist governments, and they feel like it's totally a good decision to waste tax moneys cuddling bitches.
[deleted]
-SoItGoes 10y ago
Except it's typically not his insurance, so the insurer doesn't give two fucks about some random person. You should learn to separate your point of view from someone else's - just because it helps you doesn't mean everyone wants to do it.
copralalic 10y ago
The way that the paternity test is done is that you have to have something to compare it to. They take some of the (presumed) Dad's DNA, and some of the child's DNA, then run tests on both sets. If they have certain markers in common (both have ACGGCCTTAGCCGGTCCCATAATT, for example), then that increases the likelihood they are related. Well, actually, it DEcreases the UNlikelihood, but, there ya go.
If they have one marker in common, that is 1/2 chance of being random, with each successive marker doubling the decrease in unlikelihood of them being related. 1 marker in common = 50% chance related, 2 markers = 75% chance, 3 markers = 87.5% chance, etc....
Okay, in reality it's not like that. They use certain non-coding genetic sequences with predicted prevalence in the population and the decrease is not by 50%... but just go with me on the whole "50% model" to avoid a shit-ton of nasty algebra.
[deleted] 10y ago
[deleted]
copralalic 10y ago
Yeah, I'm not about to browse pubmed for sequences to put in a reddit comment.
[deleted] 10y ago
[deleted]
[deleted] 10y ago
[deleted]
RealRational 10y ago
So split it, men pay for men women pay for women. Just like car insurance, segregated by gender.
But that will never happen, because for car's it means men pay more, but for healthcare it would mean women pay more, and we can't allow that! /s
RPthrowaway123 10y ago
That stuff is important for detecting cancer and STDs, in addition to lessening the chance of pregnancy which I am perfectly okay with.
I agree that paternity tests should be done on every child born in a hospital though.
RealRational 10y ago
ok sure, but why can't they pay for it themselves? I don't know of any insurance programs paying for my condoms. Or, when the day finally comes, my sterility shot.
tekbiotik 10y ago
Planned parenthood my brother, I don't know if they have it in your area but the place is a godsend.
[deleted] 10y ago
[deleted]
[deleted]
RPthrowaway123 10y ago
Its better than getting a chick pregnant and being the government's bitch as opposed to a little extra on my insurance.
RealRational 10y ago
Or she can buy her own damn pills that she won't take. If you don't rubber up, trusting that the bitch took her pills on time, you're one of thousands of fools who get kid-raped every year.
RPthrowaway123 10y ago
And the women who can't afford to buy their own pills? Now there's a couple thousand more men getting fucked over, in addition to their kids who will be even more impoverished than they would have been otherwise.
Point is, birth control is a good thing. Insurance should cover all forms of it for both sexes to minimize the child support rape and the unfortunate kids.
RealRational 10y ago
Those women aren't gonna take it with the regularity required to be effective anyway.
Any male who fuck's chick's without a rubber, is a moron. Short of being able to get her tested and training her well enough to call her an LTR. Low and behold, the primary advantage of engaging in an LTR.
Agreed with your closing statement though, in principle.
cheezuzz 10y ago
It's mandatory for the US government. If you want your child of a foreign mother to become a US citizen then Uncle Sam, because he's RP as fuck, demands a paternity test. If that little bastard is going to get the privileges of citizenship then it damn well better be a child of a US citizen. Uncle Sam is so RP he doesn't care if you want to support someone else's kid though. He doesn't make you get a pregnancy test to ensure your benefits only go to your children. Nope, in fact that RP badass mofo will make you keep paying for another man's child if you were dumb enough to start doing it. Why? Cause Uncle Sam is a badass motherfucker and he sure is hell isn't going to pay for that little brat when you're dumb beta faggot ass is already paying. So don't be a pussy. Get some like your Uncle does. He don't take shit from faggots. Test.
All-DayErrDay 10y ago
I swear to god the people on /r/Relationship would turn this shit around into some way where you were in the wrong.
conspirized 10y ago
Well, the right thing to do would have been to just hook up and appreciate the opportunity to feast on her clam. It's not like she offers it to every Tom, Dick, and Harry. Nine months later: I'm clearly a better father than her boyfriend could ever be and, therefore, I should provide for the child as if it were my own. It's for the good of the child!
MattyAnon Admin 10y ago
you're quite sure you are the father of the first one?
conspirized 10y ago
No doubt. Looks just like me, got a paternity test after he was born anyways and confirmed: I am the father.
MattyAnon Admin 10y ago
Good work. Is your son called Luke? ;)
conspirized 10y ago
If he was, I'd have overused that joke years ago and he'd probably be tired of it by now.
Dravous 10y ago
you didn't answer the question...
TheRedPhil 10y ago
Don't get the downvotes, you might not be a native speaker.
"If he was" is used to signify a hypothetical question, which means that his son is not called Luke.
RealRational 10y ago
Published author here, "if he was" could also simply be a diversion, he's correct that it's not an answer. It's an implication, which is far from concrete. If it's not language they would accept in court it's open to interpretation; and even by that standard, there are mis-understandings.
He could very easily say "if he was named Luke" even though he IS named Luke. It's not technically a lie since he's only implying his name isn't Luke, not directly stating it.
TheRedPhil 10y ago
That is nice to know, thanks for clearing it up. I am not native speaker myself and I couldn't remember any case I heard where it when used when condition was met.
The first example that came to my mind were "if I was a girl", which is almost never used by girls in real life, however online not knowing their identity, it would be quite possible.
conspirized 10y ago
Correct. I was neither saying he was, nor that he's not named Luke. I was very wary about posting to TRP.
Of course, when someone asked for clarification I said fuck it. "Not named Luke" isn't quite enough to Dox me.
RealRational 10y ago
your confirmation is intensively satisfying.
[deleted]
[deleted]
[deleted]
[deleted]
MattBoBat 10y ago
Bravo. I thoroughly enjoyed reading your field report. You played it like a champ, not missing any of the subtle things she said or did that tipped you off, and that put you 10 steps ahead of her.
I can appreciate the little fun you had there at the end with the whole "I'll grab some condoms on the way over". Bet she felt defeated at the very moment. You can never feel bad for a woman who is trying to pawn off another mans offspring on you as your own... it's just sick.
redpillersinparis 10y ago
Why does she want to claim that you are the father though? you have more money than her "boyfriend"?
conspirized 10y ago
Someone else nailed it, actually:
From /u/jb_trp
I make more money, have more status, and I'm more attractive. I'm better than her current boyfriend in all measures of SMV. Not being cocky here, it's just a fact.
PIGamer86 10y ago
Fucking solid. Do not waver man!
putsch80 10y ago
Throw some gas on the fire: Send screencaps of the texts to the bf. Tell him you aren't sure if the kid is his or yours, and that he needs to get a paternity test done. That will make for a fun ~9 months for the both of them.
thisiskindofmessedup 10y ago
I can't believe this is upvoted so much. This is unnecessary bullshit that women do. You don't know what kind of story she will give to this guy. Instant problems between OP and this guy.
OP don't spend energy doing bullshit like this. Just keep doing you bro.
conspirized 10y ago
I considered it, but the drama isn't worth my time.
shiteonakite 10y ago
fully agree taking the nuclear option can often lead to more stress than it's worth.
darkrood 10y ago
Somehow, I can still imagine op's ex-wife will come out unscathed, while the boyfriend would be all up in op's face about trying to sleep with his "gurl"~~
conspirized 10y ago
I'll risk sounding cocky.
He knows better.
putsch80 10y ago
Fair point. While possibly fun, the danger with throwing gas on the fire is you can also get burned.
[deleted] 10y ago
[deleted]
marrio91 10y ago
With that kind of crazy, the kid is already a stress machine at this point.
putsch80 10y ago
While I don't necessarily disagree with you, this kind of thinking is what allows women to get away with this shit
Let's say he waits until the child is born and just plays it straight by telling the bf the mom was trying to slut it up with OP. Will the situation be an less stressful on the half sibling? Is it any less fair to the newborn child that his parents will likely separate as a result? Or that the mom's breast milk production will probably decrease from the stress? Or that the house will become a stressful environment where a newborn might not thrive?
Deresetese 10y ago
She will get away with being a slut. But that's not a problem, none of this is. Her second child has no connection to OP and is really not worth his time. She and her bf will take care of the second child, OP will take care of his child.
Any actions against her is only pointless revenge which will hurt an unborn, himself, his child and the bf of his ex.
She won't change anyway
link5057 10y ago
If the moms pulls this shit with her ex, shell pull it with someone else I'd bet. Let her ruin her own life, op doesn't have to do it for her
[deleted] 10y ago
Not his kid, not his problem.
[deleted] 10y ago
[deleted]
[deleted] 10y ago
Fair enough, I don't think that not giving this chick her way is going to stress out the fetus that badly.
s0nicfreak 10y ago
The idea that stress affects fetuses is 99.99% bullshit. Think of how much more stressful our lives would have been in the past- caveman times, times of war, or heck how stressful life is today in a 3rd world country - but fetuses were just fine.
[deleted] 10y ago
[deleted]
s0nicfreak 10y ago
As a biologist, I need to point out that you're a kickboxing kangaroo.
copralalic 10y ago
I don't know about stress, but nutrition is important. Children of observant Muslim mothers who fasted during Ramadan while pregnant lag behind their classmates in many categories. Muslim clerics have since issued a judgment/decision that it is good for a woman to honor Ramadan, but if she is pregnant she can honor the holy month by fasting next year.
s0nicfreak 10y ago
Yep. Stress doesn't make much difference, but other things that are going on that would CAUSE stress (famine, bombs letting off toxic fumes or radiation, etc. etc.) does. I'm guessing this is where the misconception is rooted.
[deleted] 10y ago
[deleted]
s0nicfreak 10y ago
Okay. I'm sure it was stress and not bits of whatever the bomb was made of.
rpscrote 10y ago
Keep the whole text conversation and take screenshots of you eventually also saying NO. I wouldn't put it past her to delete anything after you saying "Yeah lets bang" then screenshotting it like that's what actually happened
conspirized 10y ago
I don't see how it would matter, but due to the whole custody thing all of our communications (even in person) are recorded. Thanks to law in my local state, I am able to do this without her consent or knowledge.
rpscrote 10y ago
I doubt it would amount to anything, but smoking gun proof can put down an attempt more quickly and save you the time and trouble a less certain situation might entail. The all communications recorded thing likely covers you though, good call!
dacostack 10y ago
Get a vasectomy and fuck the shit out of her for as long as she's up for it.
Let's take bets on how long it goes before she starts asking questions.
agmatine 10y ago
Just remember, it takes ~3 months for a vasectomy to be effective.
conspirized 10y ago
Problem is I'm not completely against having kids in the future if I find a chick that is legitimately worth my time and commitment.
I'll just wrap it up and stick to fresh meat.
[deleted] 10y ago
Sounds reasonable. I had a co-worker where I used to work. He was a solid dude. He didn't like me because he'd picked up a girl that had been in to me and whom I turned down because of her mustache. And there was another girl I met online who turned out to be 'big' but not 'beautiful' (I like the bigger girls), and he ended up picking up on her.
Anyways... the mustache lady got knocked up, told this guy it was his, got child support from him, and then move the baby to the other side of the country so he could only see 'his' daughter once a year while she still collected child support and didn't work.
I deleted her from Facebook and she inboxed me "Why" and I said: "Because you took your daughter away from her father and still expect him to pay; I grew up without a father and you don't know how lucky you are to have a guy who is involved, and then you shit all over him."
She got pissed and told him about and he turned super icy cold on me, but I later found out from one of her female friends that she was banging some addict she use to hang out with and was pretty sure that the baby was his, but she knew the other guy would actually pay the child support and the addict was a dead beat, so she hung it on him without telling him that it likely wasn't his.
I felt so bad for the guy, but I had know clue how to tell him because it had been like over two years since the kid was born and he loved her.
Pathetic how some people play games with people's lives like that. Their own children's lives no less.
cover20 10y ago
The part about receiving CS was for the kid's own good. Nobody else would pay that money to them. Granted he would have been a good (step)dad in person too, but as the kid grew up looking nothing like him maybe questions would be asked ... better to go away and keep him sending money, financially anyway.
[deleted] 10y ago
The daughter look identical to her mother, so it wouldn't have been a question that went through her mind.
But they guy has a wife now and plans on having children with her, but his support payments are going to take money out of his own kids mouths and put it into the mouth of some kid a couple of addicts had.
Don't get me wrong. I'm a socialist, but one person shouldn't have to take on that burden.
[deleted]
kick6 10y ago
U wot? She can't even provide her own fucking transportation?
conspirized 10y ago
She doesn't have a car, and why pay for one when there's always a guy willing to transport her? I realize that, in this situation, I was that guy but... I needed a parental plan put together and I needed a signature. My time is much cheaper than my lawyer's.
[deleted] 10y ago
[deleted]
Cant_Tell_Me_Nothin 10y ago
I think it has got to do more with OP being smart enough to catch it.
[deleted] 10y ago
Nope. This is still not far from the normal woman [can also be read as averagely or slightly crazy].
newls 10y ago
Hormones. Women are creatures of emotion. Their hormones and core programming make them do some funny stuff, hamstering it all as they go along. I just find it amusing to watch now. Like a child getting all in a fuss over some trivial strife.
[deleted]
[deleted]